Review



human fcar r d systems  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    R&D Systems human fcar r d systems
    Human Fcar R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fcar+r+d+systems/Recombinant+Human+FCAR%2FCD89+Protein%2C+CF/pm30057110-469-223-225
    Average 90 stars, based on 3 article reviews
    human fcar r d systems - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    FACS:

    Article Title: An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-human/mouse/rat Neuropilin-2 antibody R&D Systems Cat# AF2215 Goat polyclonal anti-human CD46 antibody R&D Systems Cat# AF2005 Mouse monoclonal anti-Thrombomodulin antibody Abcam Cat# ab33513 Goat polyclonal anti-TGFbRIII antibody Sigma Cat# T1940 Sheep polyclonal IgG R&D Cat# 5-001-A Goat polyclonal anti-CMV pp71 (vC-20) antibody Santa Cruz Biotechnology Cat# SC-33323 Mouse monoclonal anti-CMV pp72 (6E1) antibody Santa Cruz Biotechnology Cat# SC-69834 Rabbit anti-goat IgG (H+L) superclonal secondary antibody, Alex Fluor 594 ThermoFisher Cat# A27016 Donkey anti-sheep IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488 ThermoFisher Cat# A11015 F(ab’)2-goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 ThermoFisher Cat# A11020 Alexa Fluor 647 AffiniPure Donkey Anti-Human IgG (H+L) Jackson Immunoresearch Cat# 709-605-149 Goat Anti-Human IgG, Fcg fragment specific Jackson Immunoresearch Cat# 109-155-008 3G16 Antibody Macagno et al., 2010 N/A anti-CD46 R&D systems AF2005 anti-Thrombomodulin Abcam clone 141C01 anti-TGFbRIII a Sigma T1940 Pan-Nrp Antibody Appleton et al., 2007 N/A MSL109 Ciferri et al., 2015a N/A anti-HCMV pp72/86, clone 5D2 Kabanova et al., 2016 N/A anti-PDGFRa for FACS BD Biosciences clone aR1 anti-PDGFRa for western blot clone C-9 Santa Cruz Biotechnology anti-alpha-Tubulin clone B-7 Santa Cruz Biotechnology Anti- Strep,Tag II Monoclonal Antibody Novagen 71591-3 Bacterial and Virus Strains HCMV clinical isolate VR1814 Virologia e Microbiologia, Fondazione IRCCS Policlinico N/A Chemicals, Peptides, and Recombinant Proteins Human LILRB3 R&D Systems Cat# 9159-T5-050 Human FCAR R&D Systems Cat# 3939-FA-050 Human Neuropilin-1 R&D Systems Cat# 3870-N1-025 Human Neuropilin-2 R&D Systems Cat# 2215-N2-025 Human TGFb1 R&D Systems Cat# 240-B-002 Human NELL1 R&D Systems Cat# 5487-NL-050 Nitrocefin Millipore Sigma Cat# 484400 D-desthiobiotin Millipore Sigma Cat# 71610 Lipofectamine 2000 Transfection Reagent ThermoFisher Cat# 11668-019 Lipofectamine RNAiMAX Transfection Reagent ThermoFisher Cat# 13778030 DMEM/F-12 ThermoFisher Cat# 11320033 GlutaMAX supplement ThermoFisher Cat# 35050061 Penicillin-Streptomycin ThermoFisher Cat# 10378016 (Continued on next page) Cell 174, 1–14.e1–e10, August 23, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) ThermoFisher Cat# 10500064 Minimum Essential Medium Eagle Sigma Aldrich Cat# M2279 MEM Non-Essential Amino Acids Solution ThermoFisher Cat# 11140050 MEM Sodium Pyruvate ThermoFisher Cat# 11360070 Geneticin ThermoFisher Cat# 10131027 Iscove’s Modified Dulbecco’s Medium (IMDM) ThermoFisher Cat# 12440079 EndoGRO-VEGF Complete Culture Media Millipore Sigma Cat# SCME002 Expi293 Expression Medium ThermoFisher Cat# A1435101 Puromycin Dihydrochloride ThermoFisher Cat# A1113803 Hyclone HyCell TransFx-H Media ThermoFisher Cat# SH3093902 JetPEI Polyplus transfection 101B-010N DiSuccinimidylSuberate (1:1 DSS-H12/DSS-D12) Creative Molecules Cat# 001S Pimelic acid-d0 dihydrazide Sigma Cat# S364576 Pimelic-d10 acid dihydrazide Sigma Cat# 756903 DMTMM (4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4methylmorpholinium chloride) Sigma Cat# 74104 Tris-(2-carboxyethyl)phosphine hydrochloride Sigma Cat# C4706 Iodoacetamide Sigma Cat# I1149 Lys-C endopeptidase, mass spectrometry grade Wako Cat# 125-05061 Sequencing grade modified trypsin Promega Cat# V5111 FLAG Peptide Sigma-Aldrich Cat# F3290 Europium Cryptate Cisbio Cat# 62EUSPEA Critical Commercial Assays Plasma membrane protein extraction kit Abcam Cat# ab65400 Deposited Data Mass spectrometry raw data for IPMS PRIDE PXD006269 Chemical crosslinking coupled to mass spectrometry PRIDE PXD007185 Electron Microscopy EMD EMD-8884 Experimental Models: Cell Lines Expi293F cells ThermoFisher Cat# A14527 ARPE-19 ATCC Cat# CRL-2302 HAP-1 Horizon Discovery Cat# C859 HAP-1 Nrp2 KO Horizon Discovery Cat# HZGHC006066c003 HAP-1 CD46 KO Horizon Discovery Cat# HZGHC003438c008 HAP-1 TGFbRIII KO This paper N/A MRC-9 ATCC Cat# CCL-212 HEK293FT ThermoFisher Cat# R70007 HUVEC Lonza and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy N/A Oligonucleotides Nrp2 guide RNA: 50_GGGTAGTCCTGGGGGTAACC_30 This paper N/A CD46 guide RNA: 50_TTTGTGATCGGAATCATACA_30 This paper N/A TGFbRIII guide RNA: 50_ GGCTAAACAGGAGCTCATCA _30 This paper N/A Nrp2 siRNA: 50_ AGAUUGUCCUCAACUUCAAtt_30 This paper N/A CD46 siRNA: 50_ CGAGUAGAUUAUAAGUGUAtt_30 This paper N/A TGFbRIII siRNA: 50_ GGAUGUCUCAUUACACCAUtt_30 This paper N/A THBD siRNA: 50_ AAAUGGUAAUUGUUGCUAAtt_30 This paper N/A (Continued on next page) e2 Cell 174, 1–14.e1–e10, August 23, 2018 Please cite this article in press as: Martinez-Martin et al., An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor, Cell (2018), https://doi.org/10.1016/j.cell.2018.06.028

    Western Blot:

    Article Title: An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-human/mouse/rat Neuropilin-2 antibody R&D Systems Cat# AF2215 Goat polyclonal anti-human CD46 antibody R&D Systems Cat# AF2005 Mouse monoclonal anti-Thrombomodulin antibody Abcam Cat# ab33513 Goat polyclonal anti-TGFbRIII antibody Sigma Cat# T1940 Sheep polyclonal IgG R&D Cat# 5-001-A Goat polyclonal anti-CMV pp71 (vC-20) antibody Santa Cruz Biotechnology Cat# SC-33323 Mouse monoclonal anti-CMV pp72 (6E1) antibody Santa Cruz Biotechnology Cat# SC-69834 Rabbit anti-goat IgG (H+L) superclonal secondary antibody, Alex Fluor 594 ThermoFisher Cat# A27016 Donkey anti-sheep IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488 ThermoFisher Cat# A11015 F(ab’)2-goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 ThermoFisher Cat# A11020 Alexa Fluor 647 AffiniPure Donkey Anti-Human IgG (H+L) Jackson Immunoresearch Cat# 709-605-149 Goat Anti-Human IgG, Fcg fragment specific Jackson Immunoresearch Cat# 109-155-008 3G16 Antibody Macagno et al., 2010 N/A anti-CD46 R&D systems AF2005 anti-Thrombomodulin Abcam clone 141C01 anti-TGFbRIII a Sigma T1940 Pan-Nrp Antibody Appleton et al., 2007 N/A MSL109 Ciferri et al., 2015a N/A anti-HCMV pp72/86, clone 5D2 Kabanova et al., 2016 N/A anti-PDGFRa for FACS BD Biosciences clone aR1 anti-PDGFRa for western blot clone C-9 Santa Cruz Biotechnology anti-alpha-Tubulin clone B-7 Santa Cruz Biotechnology Anti- Strep,Tag II Monoclonal Antibody Novagen 71591-3 Bacterial and Virus Strains HCMV clinical isolate VR1814 Virologia e Microbiologia, Fondazione IRCCS Policlinico N/A Chemicals, Peptides, and Recombinant Proteins Human LILRB3 R&D Systems Cat# 9159-T5-050 Human FCAR R&D Systems Cat# 3939-FA-050 Human Neuropilin-1 R&D Systems Cat# 3870-N1-025 Human Neuropilin-2 R&D Systems Cat# 2215-N2-025 Human TGFb1 R&D Systems Cat# 240-B-002 Human NELL1 R&D Systems Cat# 5487-NL-050 Nitrocefin Millipore Sigma Cat# 484400 D-desthiobiotin Millipore Sigma Cat# 71610 Lipofectamine 2000 Transfection Reagent ThermoFisher Cat# 11668-019 Lipofectamine RNAiMAX Transfection Reagent ThermoFisher Cat# 13778030 DMEM/F-12 ThermoFisher Cat# 11320033 GlutaMAX supplement ThermoFisher Cat# 35050061 Penicillin-Streptomycin ThermoFisher Cat# 10378016 (Continued on next page) Cell 174, 1–14.e1–e10, August 23, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) ThermoFisher Cat# 10500064 Minimum Essential Medium Eagle Sigma Aldrich Cat# M2279 MEM Non-Essential Amino Acids Solution ThermoFisher Cat# 11140050 MEM Sodium Pyruvate ThermoFisher Cat# 11360070 Geneticin ThermoFisher Cat# 10131027 Iscove’s Modified Dulbecco’s Medium (IMDM) ThermoFisher Cat# 12440079 EndoGRO-VEGF Complete Culture Media Millipore Sigma Cat# SCME002 Expi293 Expression Medium ThermoFisher Cat# A1435101 Puromycin Dihydrochloride ThermoFisher Cat# A1113803 Hyclone HyCell TransFx-H Media ThermoFisher Cat# SH3093902 JetPEI Polyplus transfection 101B-010N DiSuccinimidylSuberate (1:1 DSS-H12/DSS-D12) Creative Molecules Cat# 001S Pimelic acid-d0 dihydrazide Sigma Cat# S364576 Pimelic-d10 acid dihydrazide Sigma Cat# 756903 DMTMM (4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4methylmorpholinium chloride) Sigma Cat# 74104 Tris-(2-carboxyethyl)phosphine hydrochloride Sigma Cat# C4706 Iodoacetamide Sigma Cat# I1149 Lys-C endopeptidase, mass spectrometry grade Wako Cat# 125-05061 Sequencing grade modified trypsin Promega Cat# V5111 FLAG Peptide Sigma-Aldrich Cat# F3290 Europium Cryptate Cisbio Cat# 62EUSPEA Critical Commercial Assays Plasma membrane protein extraction kit Abcam Cat# ab65400 Deposited Data Mass spectrometry raw data for IPMS PRIDE PXD006269 Chemical crosslinking coupled to mass spectrometry PRIDE PXD007185 Electron Microscopy EMD EMD-8884 Experimental Models: Cell Lines Expi293F cells ThermoFisher Cat# A14527 ARPE-19 ATCC Cat# CRL-2302 HAP-1 Horizon Discovery Cat# C859 HAP-1 Nrp2 KO Horizon Discovery Cat# HZGHC006066c003 HAP-1 CD46 KO Horizon Discovery Cat# HZGHC003438c008 HAP-1 TGFbRIII KO This paper N/A MRC-9 ATCC Cat# CCL-212 HEK293FT ThermoFisher Cat# R70007 HUVEC Lonza and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy N/A Oligonucleotides Nrp2 guide RNA: 50_GGGTAGTCCTGGGGGTAACC_30 This paper N/A CD46 guide RNA: 50_TTTGTGATCGGAATCATACA_30 This paper N/A TGFbRIII guide RNA: 50_ GGCTAAACAGGAGCTCATCA _30 This paper N/A Nrp2 siRNA: 50_ AGAUUGUCCUCAACUUCAAtt_30 This paper N/A CD46 siRNA: 50_ CGAGUAGAUUAUAAGUGUAtt_30 This paper N/A TGFbRIII siRNA: 50_ GGAUGUCUCAUUACACCAUtt_30 This paper N/A THBD siRNA: 50_ AAAUGGUAAUUGUUGCUAAtt_30 This paper N/A (Continued on next page) e2 Cell 174, 1–14.e1–e10, August 23, 2018 Please cite this article in press as: Martinez-Martin et al., An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor, Cell (2018), https://doi.org/10.1016/j.cell.2018.06.028

    Strep-tag:

    Article Title: An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-human/mouse/rat Neuropilin-2 antibody R&D Systems Cat# AF2215 Goat polyclonal anti-human CD46 antibody R&D Systems Cat# AF2005 Mouse monoclonal anti-Thrombomodulin antibody Abcam Cat# ab33513 Goat polyclonal anti-TGFbRIII antibody Sigma Cat# T1940 Sheep polyclonal IgG R&D Cat# 5-001-A Goat polyclonal anti-CMV pp71 (vC-20) antibody Santa Cruz Biotechnology Cat# SC-33323 Mouse monoclonal anti-CMV pp72 (6E1) antibody Santa Cruz Biotechnology Cat# SC-69834 Rabbit anti-goat IgG (H+L) superclonal secondary antibody, Alex Fluor 594 ThermoFisher Cat# A27016 Donkey anti-sheep IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488 ThermoFisher Cat# A11015 F(ab’)2-goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 ThermoFisher Cat# A11020 Alexa Fluor 647 AffiniPure Donkey Anti-Human IgG (H+L) Jackson Immunoresearch Cat# 709-605-149 Goat Anti-Human IgG, Fcg fragment specific Jackson Immunoresearch Cat# 109-155-008 3G16 Antibody Macagno et al., 2010 N/A anti-CD46 R&D systems AF2005 anti-Thrombomodulin Abcam clone 141C01 anti-TGFbRIII a Sigma T1940 Pan-Nrp Antibody Appleton et al., 2007 N/A MSL109 Ciferri et al., 2015a N/A anti-HCMV pp72/86, clone 5D2 Kabanova et al., 2016 N/A anti-PDGFRa for FACS BD Biosciences clone aR1 anti-PDGFRa for western blot clone C-9 Santa Cruz Biotechnology anti-alpha-Tubulin clone B-7 Santa Cruz Biotechnology Anti- Strep,Tag II Monoclonal Antibody Novagen 71591-3 Bacterial and Virus Strains HCMV clinical isolate VR1814 Virologia e Microbiologia, Fondazione IRCCS Policlinico N/A Chemicals, Peptides, and Recombinant Proteins Human LILRB3 R&D Systems Cat# 9159-T5-050 Human FCAR R&D Systems Cat# 3939-FA-050 Human Neuropilin-1 R&D Systems Cat# 3870-N1-025 Human Neuropilin-2 R&D Systems Cat# 2215-N2-025 Human TGFb1 R&D Systems Cat# 240-B-002 Human NELL1 R&D Systems Cat# 5487-NL-050 Nitrocefin Millipore Sigma Cat# 484400 D-desthiobiotin Millipore Sigma Cat# 71610 Lipofectamine 2000 Transfection Reagent ThermoFisher Cat# 11668-019 Lipofectamine RNAiMAX Transfection Reagent ThermoFisher Cat# 13778030 DMEM/F-12 ThermoFisher Cat# 11320033 GlutaMAX supplement ThermoFisher Cat# 35050061 Penicillin-Streptomycin ThermoFisher Cat# 10378016 (Continued on next page) Cell 174, 1–14.e1–e10, August 23, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) ThermoFisher Cat# 10500064 Minimum Essential Medium Eagle Sigma Aldrich Cat# M2279 MEM Non-Essential Amino Acids Solution ThermoFisher Cat# 11140050 MEM Sodium Pyruvate ThermoFisher Cat# 11360070 Geneticin ThermoFisher Cat# 10131027 Iscove’s Modified Dulbecco’s Medium (IMDM) ThermoFisher Cat# 12440079 EndoGRO-VEGF Complete Culture Media Millipore Sigma Cat# SCME002 Expi293 Expression Medium ThermoFisher Cat# A1435101 Puromycin Dihydrochloride ThermoFisher Cat# A1113803 Hyclone HyCell TransFx-H Media ThermoFisher Cat# SH3093902 JetPEI Polyplus transfection 101B-010N DiSuccinimidylSuberate (1:1 DSS-H12/DSS-D12) Creative Molecules Cat# 001S Pimelic acid-d0 dihydrazide Sigma Cat# S364576 Pimelic-d10 acid dihydrazide Sigma Cat# 756903 DMTMM (4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4methylmorpholinium chloride) Sigma Cat# 74104 Tris-(2-carboxyethyl)phosphine hydrochloride Sigma Cat# C4706 Iodoacetamide Sigma Cat# I1149 Lys-C endopeptidase, mass spectrometry grade Wako Cat# 125-05061 Sequencing grade modified trypsin Promega Cat# V5111 FLAG Peptide Sigma-Aldrich Cat# F3290 Europium Cryptate Cisbio Cat# 62EUSPEA Critical Commercial Assays Plasma membrane protein extraction kit Abcam Cat# ab65400 Deposited Data Mass spectrometry raw data for IPMS PRIDE PXD006269 Chemical crosslinking coupled to mass spectrometry PRIDE PXD007185 Electron Microscopy EMD EMD-8884 Experimental Models: Cell Lines Expi293F cells ThermoFisher Cat# A14527 ARPE-19 ATCC Cat# CRL-2302 HAP-1 Horizon Discovery Cat# C859 HAP-1 Nrp2 KO Horizon Discovery Cat# HZGHC006066c003 HAP-1 CD46 KO Horizon Discovery Cat# HZGHC003438c008 HAP-1 TGFbRIII KO This paper N/A MRC-9 ATCC Cat# CCL-212 HEK293FT ThermoFisher Cat# R70007 HUVEC Lonza and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy N/A Oligonucleotides Nrp2 guide RNA: 50_GGGTAGTCCTGGGGGTAACC_30 This paper N/A CD46 guide RNA: 50_TTTGTGATCGGAATCATACA_30 This paper N/A TGFbRIII guide RNA: 50_ GGCTAAACAGGAGCTCATCA _30 This paper N/A Nrp2 siRNA: 50_ AGAUUGUCCUCAACUUCAAtt_30 This paper N/A CD46 siRNA: 50_ CGAGUAGAUUAUAAGUGUAtt_30 This paper N/A TGFbRIII siRNA: 50_ GGAUGUCUCAUUACACCAUtt_30 This paper N/A THBD siRNA: 50_ AAAUGGUAAUUGUUGCUAAtt_30 This paper N/A (Continued on next page) e2 Cell 174, 1–14.e1–e10, August 23, 2018 Please cite this article in press as: Martinez-Martin et al., An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor, Cell (2018), https://doi.org/10.1016/j.cell.2018.06.028

    Virus:

    Article Title: An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-human/mouse/rat Neuropilin-2 antibody R&D Systems Cat# AF2215 Goat polyclonal anti-human CD46 antibody R&D Systems Cat# AF2005 Mouse monoclonal anti-Thrombomodulin antibody Abcam Cat# ab33513 Goat polyclonal anti-TGFbRIII antibody Sigma Cat# T1940 Sheep polyclonal IgG R&D Cat# 5-001-A Goat polyclonal anti-CMV pp71 (vC-20) antibody Santa Cruz Biotechnology Cat# SC-33323 Mouse monoclonal anti-CMV pp72 (6E1) antibody Santa Cruz Biotechnology Cat# SC-69834 Rabbit anti-goat IgG (H+L) superclonal secondary antibody, Alex Fluor 594 ThermoFisher Cat# A27016 Donkey anti-sheep IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488 ThermoFisher Cat# A11015 F(ab’)2-goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 ThermoFisher Cat# A11020 Alexa Fluor 647 AffiniPure Donkey Anti-Human IgG (H+L) Jackson Immunoresearch Cat# 709-605-149 Goat Anti-Human IgG, Fcg fragment specific Jackson Immunoresearch Cat# 109-155-008 3G16 Antibody Macagno et al., 2010 N/A anti-CD46 R&D systems AF2005 anti-Thrombomodulin Abcam clone 141C01 anti-TGFbRIII a Sigma T1940 Pan-Nrp Antibody Appleton et al., 2007 N/A MSL109 Ciferri et al., 2015a N/A anti-HCMV pp72/86, clone 5D2 Kabanova et al., 2016 N/A anti-PDGFRa for FACS BD Biosciences clone aR1 anti-PDGFRa for western blot clone C-9 Santa Cruz Biotechnology anti-alpha-Tubulin clone B-7 Santa Cruz Biotechnology Anti- Strep,Tag II Monoclonal Antibody Novagen 71591-3 Bacterial and Virus Strains HCMV clinical isolate VR1814 Virologia e Microbiologia, Fondazione IRCCS Policlinico N/A Chemicals, Peptides, and Recombinant Proteins Human LILRB3 R&D Systems Cat# 9159-T5-050 Human FCAR R&D Systems Cat# 3939-FA-050 Human Neuropilin-1 R&D Systems Cat# 3870-N1-025 Human Neuropilin-2 R&D Systems Cat# 2215-N2-025 Human TGFb1 R&D Systems Cat# 240-B-002 Human NELL1 R&D Systems Cat# 5487-NL-050 Nitrocefin Millipore Sigma Cat# 484400 D-desthiobiotin Millipore Sigma Cat# 71610 Lipofectamine 2000 Transfection Reagent ThermoFisher Cat# 11668-019 Lipofectamine RNAiMAX Transfection Reagent ThermoFisher Cat# 13778030 DMEM/F-12 ThermoFisher Cat# 11320033 GlutaMAX supplement ThermoFisher Cat# 35050061 Penicillin-Streptomycin ThermoFisher Cat# 10378016 (Continued on next page) Cell 174, 1–14.e1–e10, August 23, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) ThermoFisher Cat# 10500064 Minimum Essential Medium Eagle Sigma Aldrich Cat# M2279 MEM Non-Essential Amino Acids Solution ThermoFisher Cat# 11140050 MEM Sodium Pyruvate ThermoFisher Cat# 11360070 Geneticin ThermoFisher Cat# 10131027 Iscove’s Modified Dulbecco’s Medium (IMDM) ThermoFisher Cat# 12440079 EndoGRO-VEGF Complete Culture Media Millipore Sigma Cat# SCME002 Expi293 Expression Medium ThermoFisher Cat# A1435101 Puromycin Dihydrochloride ThermoFisher Cat# A1113803 Hyclone HyCell TransFx-H Media ThermoFisher Cat# SH3093902 JetPEI Polyplus transfection 101B-010N DiSuccinimidylSuberate (1:1 DSS-H12/DSS-D12) Creative Molecules Cat# 001S Pimelic acid-d0 dihydrazide Sigma Cat# S364576 Pimelic-d10 acid dihydrazide Sigma Cat# 756903 DMTMM (4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4methylmorpholinium chloride) Sigma Cat# 74104 Tris-(2-carboxyethyl)phosphine hydrochloride Sigma Cat# C4706 Iodoacetamide Sigma Cat# I1149 Lys-C endopeptidase, mass spectrometry grade Wako Cat# 125-05061 Sequencing grade modified trypsin Promega Cat# V5111 FLAG Peptide Sigma-Aldrich Cat# F3290 Europium Cryptate Cisbio Cat# 62EUSPEA Critical Commercial Assays Plasma membrane protein extraction kit Abcam Cat# ab65400 Deposited Data Mass spectrometry raw data for IPMS PRIDE PXD006269 Chemical crosslinking coupled to mass spectrometry PRIDE PXD007185 Electron Microscopy EMD EMD-8884 Experimental Models: Cell Lines Expi293F cells ThermoFisher Cat# A14527 ARPE-19 ATCC Cat# CRL-2302 HAP-1 Horizon Discovery Cat# C859 HAP-1 Nrp2 KO Horizon Discovery Cat# HZGHC006066c003 HAP-1 CD46 KO Horizon Discovery Cat# HZGHC003438c008 HAP-1 TGFbRIII KO This paper N/A MRC-9 ATCC Cat# CCL-212 HEK293FT ThermoFisher Cat# R70007 HUVEC Lonza and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy N/A Oligonucleotides Nrp2 guide RNA: 50_GGGTAGTCCTGGGGGTAACC_30 This paper N/A CD46 guide RNA: 50_TTTGTGATCGGAATCATACA_30 This paper N/A TGFbRIII guide RNA: 50_ GGCTAAACAGGAGCTCATCA _30 This paper N/A Nrp2 siRNA: 50_ AGAUUGUCCUCAACUUCAAtt_30 This paper N/A CD46 siRNA: 50_ CGAGUAGAUUAUAAGUGUAtt_30 This paper N/A TGFbRIII siRNA: 50_ GGAUGUCUCAUUACACCAUtt_30 This paper N/A THBD siRNA: 50_ AAAUGGUAAUUGUUGCUAAtt_30 This paper N/A (Continued on next page) e2 Cell 174, 1–14.e1–e10, August 23, 2018 Please cite this article in press as: Martinez-Martin et al., An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor, Cell (2018), https://doi.org/10.1016/j.cell.2018.06.028

    Recombinant:

    Article Title: An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-human/mouse/rat Neuropilin-2 antibody R&D Systems Cat# AF2215 Goat polyclonal anti-human CD46 antibody R&D Systems Cat# AF2005 Mouse monoclonal anti-Thrombomodulin antibody Abcam Cat# ab33513 Goat polyclonal anti-TGFbRIII antibody Sigma Cat# T1940 Sheep polyclonal IgG R&D Cat# 5-001-A Goat polyclonal anti-CMV pp71 (vC-20) antibody Santa Cruz Biotechnology Cat# SC-33323 Mouse monoclonal anti-CMV pp72 (6E1) antibody Santa Cruz Biotechnology Cat# SC-69834 Rabbit anti-goat IgG (H+L) superclonal secondary antibody, Alex Fluor 594 ThermoFisher Cat# A27016 Donkey anti-sheep IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488 ThermoFisher Cat# A11015 F(ab’)2-goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 ThermoFisher Cat# A11020 Alexa Fluor 647 AffiniPure Donkey Anti-Human IgG (H+L) Jackson Immunoresearch Cat# 709-605-149 Goat Anti-Human IgG, Fcg fragment specific Jackson Immunoresearch Cat# 109-155-008 3G16 Antibody Macagno et al., 2010 N/A anti-CD46 R&D systems AF2005 anti-Thrombomodulin Abcam clone 141C01 anti-TGFbRIII a Sigma T1940 Pan-Nrp Antibody Appleton et al., 2007 N/A MSL109 Ciferri et al., 2015a N/A anti-HCMV pp72/86, clone 5D2 Kabanova et al., 2016 N/A anti-PDGFRa for FACS BD Biosciences clone aR1 anti-PDGFRa for western blot clone C-9 Santa Cruz Biotechnology anti-alpha-Tubulin clone B-7 Santa Cruz Biotechnology Anti- Strep,Tag II Monoclonal Antibody Novagen 71591-3 Bacterial and Virus Strains HCMV clinical isolate VR1814 Virologia e Microbiologia, Fondazione IRCCS Policlinico N/A Chemicals, Peptides, and Recombinant Proteins Human LILRB3 R&D Systems Cat# 9159-T5-050 Human FCAR R&D Systems Cat# 3939-FA-050 Human Neuropilin-1 R&D Systems Cat# 3870-N1-025 Human Neuropilin-2 R&D Systems Cat# 2215-N2-025 Human TGFb1 R&D Systems Cat# 240-B-002 Human NELL1 R&D Systems Cat# 5487-NL-050 Nitrocefin Millipore Sigma Cat# 484400 D-desthiobiotin Millipore Sigma Cat# 71610 Lipofectamine 2000 Transfection Reagent ThermoFisher Cat# 11668-019 Lipofectamine RNAiMAX Transfection Reagent ThermoFisher Cat# 13778030 DMEM/F-12 ThermoFisher Cat# 11320033 GlutaMAX supplement ThermoFisher Cat# 35050061 Penicillin-Streptomycin ThermoFisher Cat# 10378016 (Continued on next page) Cell 174, 1–14.e1–e10, August 23, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) ThermoFisher Cat# 10500064 Minimum Essential Medium Eagle Sigma Aldrich Cat# M2279 MEM Non-Essential Amino Acids Solution ThermoFisher Cat# 11140050 MEM Sodium Pyruvate ThermoFisher Cat# 11360070 Geneticin ThermoFisher Cat# 10131027 Iscove’s Modified Dulbecco’s Medium (IMDM) ThermoFisher Cat# 12440079 EndoGRO-VEGF Complete Culture Media Millipore Sigma Cat# SCME002 Expi293 Expression Medium ThermoFisher Cat# A1435101 Puromycin Dihydrochloride ThermoFisher Cat# A1113803 Hyclone HyCell TransFx-H Media ThermoFisher Cat# SH3093902 JetPEI Polyplus transfection 101B-010N DiSuccinimidylSuberate (1:1 DSS-H12/DSS-D12) Creative Molecules Cat# 001S Pimelic acid-d0 dihydrazide Sigma Cat# S364576 Pimelic-d10 acid dihydrazide Sigma Cat# 756903 DMTMM (4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4methylmorpholinium chloride) Sigma Cat# 74104 Tris-(2-carboxyethyl)phosphine hydrochloride Sigma Cat# C4706 Iodoacetamide Sigma Cat# I1149 Lys-C endopeptidase, mass spectrometry grade Wako Cat# 125-05061 Sequencing grade modified trypsin Promega Cat# V5111 FLAG Peptide Sigma-Aldrich Cat# F3290 Europium Cryptate Cisbio Cat# 62EUSPEA Critical Commercial Assays Plasma membrane protein extraction kit Abcam Cat# ab65400 Deposited Data Mass spectrometry raw data for IPMS PRIDE PXD006269 Chemical crosslinking coupled to mass spectrometry PRIDE PXD007185 Electron Microscopy EMD EMD-8884 Experimental Models: Cell Lines Expi293F cells ThermoFisher Cat# A14527 ARPE-19 ATCC Cat# CRL-2302 HAP-1 Horizon Discovery Cat# C859 HAP-1 Nrp2 KO Horizon Discovery Cat# HZGHC006066c003 HAP-1 CD46 KO Horizon Discovery Cat# HZGHC003438c008 HAP-1 TGFbRIII KO This paper N/A MRC-9 ATCC Cat# CCL-212 HEK293FT ThermoFisher Cat# R70007 HUVEC Lonza and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy N/A Oligonucleotides Nrp2 guide RNA: 50_GGGTAGTCCTGGGGGTAACC_30 This paper N/A CD46 guide RNA: 50_TTTGTGATCGGAATCATACA_30 This paper N/A TGFbRIII guide RNA: 50_ GGCTAAACAGGAGCTCATCA _30 This paper N/A Nrp2 siRNA: 50_ AGAUUGUCCUCAACUUCAAtt_30 This paper N/A CD46 siRNA: 50_ CGAGUAGAUUAUAAGUGUAtt_30 This paper N/A TGFbRIII siRNA: 50_ GGAUGUCUCAUUACACCAUtt_30 This paper N/A THBD siRNA: 50_ AAAUGGUAAUUGUUGCUAAtt_30 This paper N/A (Continued on next page) e2 Cell 174, 1–14.e1–e10, August 23, 2018 Please cite this article in press as: Martinez-Martin et al., An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor, Cell (2018), https://doi.org/10.1016/j.cell.2018.06.028

    Transfection:

    Article Title: An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-human/mouse/rat Neuropilin-2 antibody R&D Systems Cat# AF2215 Goat polyclonal anti-human CD46 antibody R&D Systems Cat# AF2005 Mouse monoclonal anti-Thrombomodulin antibody Abcam Cat# ab33513 Goat polyclonal anti-TGFbRIII antibody Sigma Cat# T1940 Sheep polyclonal IgG R&D Cat# 5-001-A Goat polyclonal anti-CMV pp71 (vC-20) antibody Santa Cruz Biotechnology Cat# SC-33323 Mouse monoclonal anti-CMV pp72 (6E1) antibody Santa Cruz Biotechnology Cat# SC-69834 Rabbit anti-goat IgG (H+L) superclonal secondary antibody, Alex Fluor 594 ThermoFisher Cat# A27016 Donkey anti-sheep IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488 ThermoFisher Cat# A11015 F(ab’)2-goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 594 ThermoFisher Cat# A11020 Alexa Fluor 647 AffiniPure Donkey Anti-Human IgG (H+L) Jackson Immunoresearch Cat# 709-605-149 Goat Anti-Human IgG, Fcg fragment specific Jackson Immunoresearch Cat# 109-155-008 3G16 Antibody Macagno et al., 2010 N/A anti-CD46 R&D systems AF2005 anti-Thrombomodulin Abcam clone 141C01 anti-TGFbRIII a Sigma T1940 Pan-Nrp Antibody Appleton et al., 2007 N/A MSL109 Ciferri et al., 2015a N/A anti-HCMV pp72/86, clone 5D2 Kabanova et al., 2016 N/A anti-PDGFRa for FACS BD Biosciences clone aR1 anti-PDGFRa for western blot clone C-9 Santa Cruz Biotechnology anti-alpha-Tubulin clone B-7 Santa Cruz Biotechnology Anti- Strep,Tag II Monoclonal Antibody Novagen 71591-3 Bacterial and Virus Strains HCMV clinical isolate VR1814 Virologia e Microbiologia, Fondazione IRCCS Policlinico N/A Chemicals, Peptides, and Recombinant Proteins Human LILRB3 R&D Systems Cat# 9159-T5-050 Human FCAR R&D Systems Cat# 3939-FA-050 Human Neuropilin-1 R&D Systems Cat# 3870-N1-025 Human Neuropilin-2 R&D Systems Cat# 2215-N2-025 Human TGFb1 R&D Systems Cat# 240-B-002 Human NELL1 R&D Systems Cat# 5487-NL-050 Nitrocefin Millipore Sigma Cat# 484400 D-desthiobiotin Millipore Sigma Cat# 71610 Lipofectamine 2000 Transfection Reagent ThermoFisher Cat# 11668-019 Lipofectamine RNAiMAX Transfection Reagent ThermoFisher Cat# 13778030 DMEM/F-12 ThermoFisher Cat# 11320033 GlutaMAX supplement ThermoFisher Cat# 35050061 Penicillin-Streptomycin ThermoFisher Cat# 10378016 (Continued on next page) Cell 174, 1–14.e1–e10, August 23, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) ThermoFisher Cat# 10500064 Minimum Essential Medium Eagle Sigma Aldrich Cat# M2279 MEM Non-Essential Amino Acids Solution ThermoFisher Cat# 11140050 MEM Sodium Pyruvate ThermoFisher Cat# 11360070 Geneticin ThermoFisher Cat# 10131027 Iscove’s Modified Dulbecco’s Medium (IMDM) ThermoFisher Cat# 12440079 EndoGRO-VEGF Complete Culture Media Millipore Sigma Cat# SCME002 Expi293 Expression Medium ThermoFisher Cat# A1435101 Puromycin Dihydrochloride ThermoFisher Cat# A1113803 Hyclone HyCell TransFx-H Media ThermoFisher Cat# SH3093902 JetPEI Polyplus transfection 101B-010N DiSuccinimidylSuberate (1:1 DSS-H12/DSS-D12) Creative Molecules Cat# 001S Pimelic acid-d0 dihydrazide Sigma Cat# S364576 Pimelic-d10 acid dihydrazide Sigma Cat# 756903 DMTMM (4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4methylmorpholinium chloride) Sigma Cat# 74104 Tris-(2-carboxyethyl)phosphine hydrochloride Sigma Cat# C4706 Iodoacetamide Sigma Cat# I1149 Lys-C endopeptidase, mass spectrometry grade Wako Cat# 125-05061 Sequencing grade modified trypsin Promega Cat# V5111 FLAG Peptide Sigma-Aldrich Cat# F3290 Europium Cryptate Cisbio Cat# 62EUSPEA Critical Commercial Assays Plasma membrane protein extraction kit Abcam Cat# ab65400 Deposited Data Mass spectrometry raw data for IPMS PRIDE PXD006269 Chemical crosslinking coupled to mass spectrometry PRIDE PXD007185 Electron Microscopy EMD EMD-8884 Experimental Models: Cell Lines Expi293F cells ThermoFisher Cat# A14527 ARPE-19 ATCC Cat# CRL-2302 HAP-1 Horizon Discovery Cat# C859 HAP-1 Nrp2 KO Horizon Discovery Cat# HZGHC006066c003 HAP-1 CD46 KO Horizon Discovery Cat# HZGHC003438c008 HAP-1 TGFbRIII KO This paper N/A MRC-9 ATCC Cat# CCL-212 HEK293FT ThermoFisher Cat# R70007 HUVEC Lonza and Fondazione IRCCS Policlinico San Matteo, Pavia, Italy N/A Oligonucleotides Nrp2 guide RNA: 50_GGGTAGTCCTGGGGGTAACC_30 This paper N/A CD46 guide RNA: 50_TTTGTGATCGGAATCATACA_30 This paper N/A TGFbRIII guide RNA: 50_ GGCTAAACAGGAGCTCATCA _30 This paper N/A Nrp2 siRNA: 50_ AGAUUGUCCUCAACUUCAAtt_30 This paper N/A CD46 siRNA: 50_ CGAGUAGAUUAUAAGUGUAtt_30 This paper N/A TGFbRIII siRNA: 50_ GGAUGUCUCAUUACACCAUtt_30 This paper N/A THBD siRNA: 50_ AAAUGGUAAUUGUUGCUAAtt_30 This paper N/A (Continued on next page) e2 Cell 174, 1–14.e1–e10, August 23, 2018 Please cite this article in press as: Martinez-Martin et al., An Unbiased Screen for Human Cytomegalovirus Identifies Neuropilin-2 as a Central Viral Receptor, Cell (2018), https://doi.org/10.1016/j.cell.2018.06.028



    Similar Products

    90
    R&D Systems human fcar r d systems
    Human Fcar R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fcar+r+d+systems/Recombinant+Human+FCAR%2FCD89+Protein%2C+CF/pm30057110-469-223-225
    Average 90 stars, based on 1 article reviews
    human fcar r d systems - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results